| Topic: |
Religions > Atheism |
| User: |
"david ford" |
| Date: |
08 Dec 2005 03:18:09 PM |
| Object: |
ISCID in November 2005 |
I reworked an email to me to get this:
ISCID Newsletter
International Society for Complexity, Information and Design
http://www.iscid.org
*Featured Book*
Biased Embryos and Evolution
http://www.amazon.com/exec/obidos/ASIN/0521541611/iscid-20
by Wallace Arthur
Wallace focuses on the question of how embryonic development changes in
the course of evolution, thus giving rise to new types of creatures.
It takes the view that biases in the ways that embryos can be altered
are as important as natural selection in determining the directions
that evolution has taken, including the one that led to the origin of
humans.
---------------------------------------
Progress in Complexity, Information and Design
Volume 4.2, November 2005
Featured Papers
The Three Domains of Life: A Challenge to the concept of the Universal
Cellular Ancestor?
by Pattle P. Pun, Stephen Schuldt, and Benjamin T. Pun
Abstract-- With the discovery of the uniqueness of Archaebacteria in
rRNA sequence and by comparative studies with well-characterized
molecular systems, cell walls, lipid compositions and features of the
transcriptional and translational machineries, the three domains of
life, namely Archaea, Bacteria and Eukarya, has become the currently
accepted paradigm in the field of molecular taxonomy. Sequence
analyses based on functional proteins across the three domains also
suggest each of the three domains as independent monophyletic lineages
representing ribosomal, metabolic, biosynthetic proteins as well as the
replicational, transcriptional and translational machineries. Current
view suggests that the universal tree of life branched from the
universal ancestor in separate lineages leading to Bacteria and
Archaea, the latter then diverged into Eukarya. The search for the
universal ancestor has led to postulating a universal communal gene
pool (progenotes) in which lateral or horizontal gene transfer (HGT)
played the most important role in diversification since the three
domains of life are resistant to HGT after they have crystallized into
cellular communities. This scenario challenges the concept of the
Universal Cellular Ancestor and may be open to alternative views based
on design.
http://www.iscid.org/pcid/2005/4/2/pun_three_domains.php
Information as a Measure of Variation
by William A. Dembski
Abstract-- Within information theory, information typically measures
the reduction of uncertainty that results from the knowledge that an
event has occurred. But what if the item of knowledge learned is not
the occurrence of an event but, rather, the change in probability
distribution associated with an ensemble of events? This paper takes
the usual account of information, which focuses on events, and
generalizes it to probability distributions/ measures. In so doing, it
facilitates the assignment of "generalized bits" to arbitrary state
transitions of physical systems. In particular, it provides a
theoretical framework for characterizing the informational continuity
of evolving systems and for rigorously assessing the degree to which
such systems exhibit, or fail to exhibit, continuous change.
http://www.iscid.org/pcid/2005/4/2/dembski_information_variation.php
Palindromati
by Fernando Castro-Chavez
Abstract-- This article describes a family of artificial
heterotranscripts (RNA chimaeras) composed by thousands of Genbank
sequences containing fragments or the complete EcoRI-like adapter
acting as the palindrome linker ctcgtgccgaattcggcacgag, binding
together two or more genes that may be produced by different
chromosomes. This happens due to current methodologies producing the
reported sequences, found in the Genbank, in Affymetrix microarrays,
and in many published articles reporting or using those sequences that
include the EcoRI-like linker inside coding regions, and/or 5'UTR or
3'UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts
are here deemed as experimental artifacts, characterization that can be
helpful to prevent errors, both in the studies of molecular mechanisms
and in the drug discovery process.
http://www.iscid.org/pcid/2005/4/2/chavez_palindromati.php
On Einstein's Razor: Telesis-Driven Introduction of Complexity into
Apparently Sufficiently Non-Complex Linguistic Systems
by Quinn Tyler Jackson
Abstract-- The notion that a linguistic system that is powerful enough
to accept any acceptable language but insufficiently complex to meet
specific goals or needs is explored. I nominate Chomsky's generative
grammar formalism as the least complex formalism required to describe
all language, but show how without the addition of further complexity,
little can be said about the formalism itself. I then demonstrate how
the O(n) parsing of pseudoknots, a previously difficult to solve
problem, becomes tractable by the more complex §-Calculus, and finally
close with a falsifiable hypothesis with implications in
epistemological complexity.
http://www.iscid.org/pcid/2005/4/2/jackson_einstein_razor.php
Bits, Bytes and Biology: What Evolutionary Algorithms (Don't) Teach
Us About Biology
by Eric Anderson
Abstract-- Far from constituting a devastating critique of irreducible
complexity, the evolutionary algorithm, Avida, is a flawed effort that
bears little relevance to the biological world. In their haste to
affirm the Darwinian creation story, the Avida authors seem oblivious
to, or conveniently ignore, the fact that they have incorporated as
premises the very conclusions they are trying to reach. Such efforts
are at best misleading, at worst deceptive. Ironically, the main piece
of data obtained by the Avida researchers that is not based on circular
evolutionary assumptions, upon closer inspection supports, rather than
refutes, Behe's notion of irreducible complexity.
http://www.iscid.org/pcid/2005/4/2/anderson_bits_bytes_biology.php
/////////////////////////////////////////////////////////////////////////////
1987 Wallace Arthur
http://groups.google.com/groups?selm=Pine.LNX.4.21L.01.0007210001340.12641-100000%40jabba.gl.umbc.edu
1983 Bruce Alberts; Haeckel's fraudulent embryo depictions; 1956
Goldschmidt
http://groups.google.com/groups?selm=dford3-38m3vrF5o7bk2U1%40individual.net
ID as a metaphysical research program
http://groups.google.co.in/groups?selm=dford3-1129317540.779352.231140%40f14g2000cwb.googlegroups.com
ID + common descent: A Proposal
http://groups.google.com/groups?selm=b1c67abe.0404181835.d59cf7d%40posting.google.com
religious faith and common descent
http://groups.google.com/groups?selm=b1c67abe.0405051933.522f5d0e%40posting.google.com
1910s remarks by Caullery, Edmund B. Wilson, and Bateson on the idea of
top-down unfolding/ [Bateson]"unpacking of an original complex which
contained within itself the whole range of diversity which living
things present"
http://groups.google.com/groups?selm=b1c67abe.0405161853.5f28f100%40posting.google.com
1993 Stephanie Forrest on genetic algorithms
http://groups.google.com/groups?selm=dford3-1132069993.082818.203300%40f14g2000cwb.googlegroups.com
computer simulations illustrate intelligent design, at the bottom of
replies to Larry Moran posts
http://groups.google.com/groups?selm=dford3-39lhabF61ut8sU1%40individual.net
.
|
|
| User: "Lt. Kizhe Catson" |
|
| Title: Re: ISCID in November 2005 |
08 Dec 2005 03:37:38 PM |
|
|
david ford wrote:
I reworked an email to me to get this:
ISCID Newsletter
International Society for Complexity, Information and Design
http://www.iscid.org
*Featured Book*
Biased Embryos and Evolution
http://www.amazon.com/exec/obidos/ASIN/0521541611/iscid-20
by Wallace Arthur
Wallace focuses on the question of how embryonic development changes in
the course of evolution, thus giving rise to new types of creatures.
It takes the view that biases in the ways that embryos can be altered
are as important as natural selection in determining the directions
that evolution has taken, including the one that led to the origin of
humans.
It sounds like a fascinating book, on the face of it. But were you (or
ISCID) under the impression that natural selection is the be-all and
end-all of evolution? Does this book somehow support ID as an alternative?
-- Kizhe
[rest snipped]
.
|
|
|
| User: "david ford" |
|
| Title: Re: ISCID in November 2005 |
09 Dec 2005 12:32:22 PM |
|
|
Lt. Kizhe Catson wrote:
david ford wrote:
I reworked an email to me to get this:
ISCID Newsletter
International Society for Complexity, Information and Design
http://www.iscid.org
*Featured Book*
Biased Embryos and Evolution
http://www.amazon.com/exec/obidos/ASIN/0521541611/iscid-20
by Wallace Arthur
Wallace focuses on the question of how embryonic development changes in
the course of evolution, thus giving rise to new types of creatures.
It takes the view that biases in the ways that embryos can be altered
are as important as natural selection in determining the directions
that evolution has taken, including the one that led to the origin of
humans.
It sounds like a fascinating book, on the face of it. But were you (or
ISCID) under the impression that natural selection is the be-all and
end-all of evolution?
Not that I know of-- I don't think so.
Schutzenberger:
wasn't a creationist; options for the blindwatchmakingist
http://groups.google.com/groups?selm=Pine.SGI.3.96.980527000035.6222A-100000%40umbc8.umbc.edu
Meaning of "evolution?"
legerdemain in the use of the word 'evolution'
http://www.google.com/groups?selm=dford3-1132102419.915797.111840%40o13g2000cwo.googlegroups.com
Dawkins and Dennett believe that Darwinian "natural selection is the
be-all and end-all of" what's needed to explain the occurrence of
alleged-blindwatchmaking.
Dawkins, Richard. "The necessity of Darwinism" _New Scientist_ (15
April 1982), 130-2. The opening paragraph + 1 sentence:
Biology is the study of the complex things in the Universe.
Physics is the study of the simple ones. It is the complexity of
life, coupled with the precision of its adaptation, that cries out
for a special kind of explanation, and a hunger for such
explanation has frequently driven people to believe in a
supernatural Creator. Complexity means statistical improbability.
The more statistically improbable a thing is, the less can we
believe that it just happened by blind chance. Superficially the
obvious alternative to chance is an intelligent Designer. But
Charles Darwin showed how it is possible for blind physical forces
to mimic the effects of conscious design, and, by operating as a
cumulative filter of chance variations, to lead eventually to
organised and adaptive complexity, to mosquitoes and mammoths, to
humans and therefore, indirectly, to books and computers. Darwin's
theory is now supported by all the available relevant evidence, and
its truth is not doubted by any serious modern biologist.
Catley on the coming Kuhnian revolution, Collingridge & Earthy
http://groups.google.com/groups?selm=Pine.SGI.3.96A.981113234219.18273B-100000%40umbc9.umbc.edu
Does this book somehow support ID as an alternative?
I don't know.
[rest snipped]
.
|
|
|
|
|
|
Related Articles |
Listen to the 2005 Bush State of the Union speech:
2005 Survey of Non-believers
Re: PROOF THAT LIBERALS ARE LIKE A TURD IN A SWIMMING POOL ==> GOP senator is the personification the 2005 Republican Party
Re: Tech Tales 2005, Vol. I
Ellen Johnson on Larry King Friday April 1, 2005
Ellen Johnson on Larry King Show on Thursday, April 13, 2005
Michigan Atheists Summer Solstice picnic - June 26, 2005
aa - QOTM winners for June 2005
| American Atheists Update: ATHEISTS IN FOXHOLES; Veteran's Day, Friday November 11, 2005
SmiteWatch 28 Jul 2005
Usenet observation of the year 2005 (winner Ben Goren)
2005 Pride Parade pics
Johnson to speak to Seattle Atheist group Sunday, August 28, 2005
Silverman-Devlin "Great Debate" -- Philadelphia, Monday, September 12, 2005
President requests prayer for Michael Brown, Sept. 1, 2005
|
|
|
